Type: Article

Evaluation of minimum inhibitory concentration and multi-drug resistance profile of Salmonella isolated from layer poultry farms in kaski district, Nepal

Suresh Nepali ¹, Sharada Thapaliya ¹, Narayan Paudyal ², Jeevan Adhikari ¹, Rajesh Gautam^3,*

^1.         Faculty of Animal Science, Veterinary Science and Fisheries, Agriculture and Forestry University, Rampur Chitwan, Rampur Chitwan 44209, Nepal

^2.         Nepal Agriculture Research Council, National Animal Health Research Centre, Khumaltar, Kathmandu 44700, Nepal

^3.         Institute of Agriculture and Animal Science, Tribhuvan University, Paklihawa, Rupandehi 33007, Nepal

^*Corresponding Author: vet.rajesh01@gmail.com

Abstract: Salmonella species are the most prevalent bacterial pathogens infecting poultry. Antibiotics are administered as growth promoters or a treatment in poultry, raising the prospect of antibiotic resistance. There are very few baselines quantitative studies on antibiotic Minimum Inhibitory Concentration (MIC) against Salmonella of poultry origin. Thus, this study aims to evaluate the MIC and multi-drug resistance (MDR) profile of Salmonella isolated from the poultry farms of Kaski district of Nepal. Laboratory analysis was conducted to determine the minimum inhibitory concentration of nineteen different antibiotic molecules from various classes against Salmonella spp. isolated from poultry feces. The bacteria were identified using standard protocols and confirmed with polymerase chain reaction for the invA gene. Positively confirmed isolates were subjected to a MIC evaluation assay by the E-Test protocol, using Ezy MIC Strips following EUCAST guidelines and interpreted accordingly. Out of 610 samples collected, on screening using the invA gene for Salmonella, 48 isolates were confirmed as Salmonella spp., with an overall farm prevalence of 34.43% (n=61) and a sample-level prevalence of 7.8%. Salmonella spp. displayed the highest resistance to colistin (100%), ciprofloxacin (88%), norfloxacin (72%), ceftriaxone (72%), amoxicillin (77%), ampicillin (66%), erythromycin (66%), cefotaxime (66%), tetracycline (66%), doxycycline (55%), and chloramphenicol (55%). However, amikacin (94%) showed higher susceptibility. MIC analysis revealed elevated values for colistin, ciprofloxacin, amoxicillin, ampicillin, ceftriaxone, and doxycycline compared to epidemiological cut-offs. Multiple drug resistance was observed in 94% of Salmonella spp. isolates, each showing unique multiple antibiotic resistance (MAR) patterns. The study highlights the concerns of antibiotic resistance in commercial layer farms in Kaski district, possibly due to excessive antibiotic use by poultry farm owners. Urgent measures are needed to address this public health issue by regulating antibiotic usage in the poultry industry in the area.

Keywords: Antibiotic resistance, Poultry, Salmonella spp., minimum inhibitory concentration, multi-drug resistance.

Submitted: 29-9-2025;       Revised: 02-10-2025;         Accepted: 05-10-20205;    Online:6-10-2025;

Cite as: Nepali, S., Thapaliya, S., Paudyal, N., Adhikari, J., Gautam, R. (2025) Evaluation of minimum inhibitory concentration and multi-drug resistance profile of salmonella isolated from layer poultry farms in kaski district, Nepal. Animal Reports 1(2): 85-99. https://doi.org/10.64636/ar.19

This work © 2025 by Author(s) is licensed under CC BY 4.0

 

1           Introduction

Antimicrobial resistance occurs when microorganisms develop the ability to survive exposure to antimicrobial agents that were previously effective in killing or inhibiting their growth (Majumder et al., 2020). If the antibiotic's minimal inhibitory concentration (MIC) for the specific bacteria is within the range of concentration that the antibiotic can attain. The bacterium is considered resistant if the MIC of the antibiotic for the concerned bacteria is greater than the concentration that can be achieved at the infection site (Kowalska-Krochmal & Dudek-Wicher, 2021). The emergence of AMR is associated with irrational, indiscriminate, and inappropriate use of antibiotics in human, veterinary, and agricultural sectors, reducing the efficacy of antimicrobial treatment and resulting in increased morbidity, mortality, and healthcare costs (Kuehn, 2022).

Salmonellosis is an infectious bacterial disease that affects poultry. It is caused by bacteria belonging to the family Enterobacteriaceae. These bacteria are gram-negative, rod-shaped, non-spore-forming, non-capsulated, and usually motile (except for S. Pullorum and S. Gallinarum). They are facultative anaerobes (Agbaje et al., 2011). Salmonellosis is considered one of the major bacterial diseases in the poultry industry worldwide, and the presence of antimicrobial-resistant Salmonella spp. in poultry and poultry products is a global public health problem causing heavy economic losses through mortality and reduced production (Kumar et al., 2019). Salmonella spp. Isolates in Nepal have been identified with varying degrees of antibiotic resistance and are capable of evading antibiotic action, representing new paradigms in pathogenesis, transmission, and resistance (Acharya & Wilson, 2019). Salmonellosis is a worldwide health concern (Mąka & Popowska, 2016) a foodborne zoonotic disease. The consumption of contaminated egg and poultry meat products is linked to 40% of clinical cases (Nair et al., 2018). It is reported that food-borne non-typhoidal Salmonella causes acute gastroenteritis and deaths with varied patterns of drug resistance in the last few decades (Maharjan et al., 2021a). Antibiotic resistance in foodborne Salmonella continues to be a recurring problem for public health efforts (Ziaul Haque et al., 2021).

Kaski District in Nepal is one of the major districts, with 2,883,326 heads of fowl (DLS, 2025). A previous study revealed the prevalence of 10% Salmonella in meat samples from poultry and the presence of multidrug-resistant Salmonella in Kaski district. Various classes of antibiotics are used therapeutically to treat Salmonella infection in poultry  (Basnyat et al., 2015; Prajapati et al., 2018).

A study by several researchers found that 75% of meat samples from Kathmandu, 11.08% from Chitwan, 21.81% from backyard chicken, and 16.04% from processed meat samples showed the prevalence of Salmonella. Additionally, 71% of NTS Salmonella was found in broiler samples in Chitwan (Fowler et al., 2021; Gautam et al., 2019; Nelson et al., 2020; A. Sharma & Tripathi, 2015; S. Sharma et al., 2021; Shrestha et al., 2010). The prevalence of salmonella was 8.13% in meat samples of livestock and poultry in the Pokhara Valley. Similarly, Salmonella isolates were shown to be resistant to amoxicillin, tetracycline, chloramphenicol, and nalidixic acid in 100%, 24%, 11%, and 11% of meat samples from Eastern Nepal, respectively (Bantawa et al., 2019). Limited research has been conducted to identify the contributing factors and drivers of antibiotic-resistant Salmonella in poultry. This study aimed to address these gaps. The objective was to assess the minimum inhibitory concentration (MIC) of commonly used antibiotics against Salmonella strains isolated from layer poultry farms in the Kaski district of Gandaki Province, Nepal.

2           Materials and Methods

2.1         Study Area

This cross-sectional study was conducted in different places in the Kaski district of Gandaki Province, Nepal, from July 2021 to July 2022. Samples were processed, and laboratory work was performed at the National Animal Health Research Center (NAHRC), Nepal Agriculture Research Center (NARC), Khumaltar, Lalitpur, Nepal (Fig. 1).

Fig. 1. Map of Study Area

2.2         Sample size and methods

The sample size was calculated by Open-Epi software version 3.01 at a 95% confidence interval with an 8% anticipated prevalence of Salmonella occurrence. 610 samples were collected from 36 farms, each with a flock size of 1000-5000 during the time of the experiment. The purposive sampling method was used to collect the samples.

2.3         Sample storage and transport

Cloacal samples were collected using individual sterile cotton swabs rubbed inside the cloaca of each bird and transferred to buffered peptone water in 15 mL Falcon tubes aseptically. In this study, a sterile drag swab was used on a littered floor to collect the litter sample. Thus, the collected drag swab was put in a 50 mL Falcon tube containing 25 mL of BPW and transported to the lab in an icebox. Five drag samples from the same pen were pooled as one pooled sample. The samples were transported to the National Animal Health Research Center (NAHRC), Khumaltar, in a styrofoam box for further processing.

2.4         Enrichment of Samples and isolation

The samples were pre-enriched in buffered peptone water and incubated for 24 hours at 37°C. Then, 1 mL of inoculum from the respective pre-enriched broth was transferred to 9 mL of Rappaport-Vassiliadis (RV10) enrichment broth. The RV10 broth was incubated at 42°C for 24 hours. Then turbid broth samples were streaked onto Xylose-Lysine-Deoxycholate (XLD) and MacConkey’s agar plates. Typical Salmonella colonies were further subcultured onto nutrient agar for morphological characterization and preservation Morphological identification was done by Gram staining(Cheesbrough, 2006).

2.5         Molecular confirmation of Salmonella using Polymerase chain reaction (PCR)

DNA was extracted from suspected Salmonella colonies using the QIAamp DNA Mini Kit following the manufacturer's protocol. (QIAGEN). End-point PCR (Table 1) was done for confirmation of Salmonella using invA gene (Zhai et al., 2014).

Table 1. Set of primers for the invA gene's endpoint PCR for Salmonella detection

Target	Gene	Primer	Sequence (5’-3')	PCR-product (bp)
Salmonella	InvA	139-141	GTGAAATTATCGCCACGTTCGGGCAA TCATCGCACCGTCAAAGGAACC	284

2.6         Selection of antibiotics for MIC assay:

Based on the responses provided by the farmers regarding the most common antibiotic molecules used on their farms as well as the sales and availability records from veterinary drug stores in the study area, nineteen antibiotics from various classes were identified. These antibiotics were used to determine the Minimum Inhibitory Concentration (MIC) against the Salmonella isolated.

2.7         Determination of MIC

The MIC was obtained using an agar diffusion method with commercially available strips containing an exponential gradient antibiotic. The Epsilometer test (E-test) determines antimicrobial resistance using an 'exponential gradient' method. The E-test was developed to provide a direct quantification of bacteria susceptibility to antibiotics (Citron et al., 1991).

2.8         Statistical analysis

Excel spreadsheets were used to compile and organize the information collected from the owners on the Epicollect5 tool and the laboratory results. Then, the data was exported, and data analysis was performed using different statistical tools.

3           Results and discussion

3.1         Prevalence of Salmonella

A total of 610 samples were taken from 61 different flocks, with 305 being cloacal samples and 305 being litter samples (Table 2)

Table 2. Prevalence of Salmonella in sample.

 

A total of 48 samples tested positive for Salmonella, representing a 7.8% sample prevalence and 34% farm prevalence as determined by PCR methods focusing on the invA gene typical of the genus (Fig. 2). The isolation rate varied depending on the sample sources, with 6.88% (21/305) of cloacal samples and 8.85% (27/305) of litter samples testing positive.

           

Fig. 2. Representative results of invA gene amplification for confirmation of Salmonella.

There are multiple reports of Salmonella in Nepalese poultry that indicate varying degrees of antimicrobial resistance. This study's finding is in alignment with the study by (S. Sharma et al., 2021), which showed a prevalence of 9% Salmonella from various farms in Chitwan. A similar study reported that 32.5% of Salmonella isolates were positive for the invA gene(Maharjan et al., 2021b). Another study conducted in five different provinces of Nepal reported a higher prevalence of 48% Salmonella spp. from cloacal swabs of layer flocks (Pal, et al., 2022). The prevalence of Salmonella in poultry is dynamic and not uniform across multiple regions of Nepal. This variation may be due to the different sampling methods, testing procedures, and the season during which the studies were performed.

There is no statistically significant difference in the isolation rate (chi-square test, p = 0.3) between drag samples and cloacal samples. A study in a poultry farm of Chitwan reported a Salmonella prevalence of 10.6% in the fecal sample and 8.6% in the litter sample, which is similar to the results of this study (S. Sharma et al., 2021).

3.2         MIC evaluation

E-Test was used to evaluate MIC for studying the dynamics of antibiotic usage, and the results were categorized according to NARMS guidelines (Table 3). E. coli ATCC 25922 was used as a control strain in all the assays. The MIC assay was done using E-Test strips (Hi-Media, India).

Table 3. Squashtogram table showing the numerical distribution of MIC of Salmonella.

 In the squashtogram (Table 3), the antibiotics used are grouped by their classes. The top row (values 256 to 0.002) denotes the two-fold serial dilution of the antibiotics in µg/ml. The shaded portion denotes that those concentrations are not used for that particular molecule. A short, bold, black vertical line along each row indicates the epidemiological cut-off values as categorized by NARMS (2020). The numbers under each concentration are the number of isolates showing that particular MIC value. This squashtogram showed that among these 19 molecules tested, classical molecules such as colistin, ciprofloxacin, norfloxacin, amoxicillin, ampicillin, erythromycin, cefotaxime, ceftriaxone, tetracycline, doxycycline, and chloramphenicol are generally more resistant, with the majority of isolates showing MIC greater than the cut-off values. It is of great importance that the majority of the isolates have an MIC higher than the cut-off value.

3.2.1        MIC of colistin

In this study, the MIC of colistin among the 18 isolates showed that the highest number of isolates, 15 (84%), had MIC 256 µg/ml, followed by 2 (11%) isolates with MIC 64 µg/ml and 1 (6%) isolate with MIC 4 µg/ml (Table 3). Regarding MIC breakpoints, 100% of isolates were resistant to colistin. According to EUCAST, 4 µg/ml is the threshold at which colistin is deemed resistant. In Nepal, a more concerning issue is the use of colistin for growth promotion, prophylaxis, and therapeutic purposes in poultry, though colistin is banned by the government (DLS, 2017). A study on antimicrobial use in animals in Nepal reported the quantities of 8452 kg and 956 kg of colistin sulphate consumed in Nepal in 2018 and 2019, predominantly administered in poultry (Upadhyaya et al., 2023a).

In Nepal, colistin resistance was found to be around 40% in Salmonella isolates (CVL, 2018). Acharya & Wilson (2019) reported the prevalence of colistin resistance was 10.7% in Salmonella spp. isolated from the poultry farm of Chitwan. Similar findings unveil a 6.6% prevalence (Ibrahim et al., 2021), and 14.7% of Salmonella isolated samples from Malaysian chicken were colistin-resistant, with MICs between 4 and 16 mg/L (Jajere et al., 2020).

3.2.2        MIC of tetracycline

In this study, regarding the MIC breakpoint, i.e., 8 µg/ml in terms of resistance, 66% of isolates were resistant to tetracycline, and 55% of isolates were resistant to doxycycline. A study across Nepal found Salmonella isolates from poultry samples to be the least susceptible to tetracycline at 23.07% and 3.3%, respectively (Gautam et al., 2019; Koirala et al., 2020). Doxycycline resistance was found to be 35% of 103 isolate samples (Fowler et al., 2021). Researchers reported the tetracycline-resistant gene tetA in 83.79% of Salmonella isolates from poultry samples in Nepal (Gyawali, 2018). The antibiotic doxycycline belongs to the broad-spectrum tetracycline class and is frequently prescribed to treat many illnesses in both humans and animals (Hossain et al., 2021).

3.2.3        MIC of fluoroquinolones

In this study, the norfloxacin MIC value was 2-256 µg/mL for 13 (72%) of isolates which showed resistance; 88% (16) of isolates were resistant to ciprofloxacin that had MIC range of >0.125-32 µg/mL, 27% of isolates were resistant to levofloxacin that had an MIC of range >4-32 µg/mL, and 44% of isolates were resistant to enrofloxacin that had MIC of range >1-32 µg/ml as shown in Table 3. Some findings unfold: 40% of the QrnS (64/157) gene was detected in Salmonella isolates that were resistant to ciprofloxacin in Nepal (Nelson et al., 2020).

3.2.4        MIC of aminoglycosides

The MIC threshold value of the aminoglycoside class of antibiotics gentamicin and amikacin was 8 µg/ml, and streptomycin was 32 µg/ml. In this study, 95% of Salmonella isolates showed susceptibility to amikacin that had an MIC range of >0.016-8 µg/ml. Similarly, 61% of isolates showed a susceptibility to gentamicin that had an MIC range of >0.25 - 4 µg/ml (Table 3). A study reported that 7% of amikacin was resistant to Salmonella in broiler flocks and 5% was resistant in layer flocks (Acharya et al., 2019). Low resistance to amikacin and gentamicin relates to reduced use of these antimicrobials and is only used in case of chronic infection in poultry production. It is available as an injectable rather than for oral administration, which requires skilled manpower. In this study, 77% of streptomycin showed a susceptibility that had an MIC in the range of >2-8 µg/ml.

3.2.5        MIC of cephalosporin

Cephalosporin has been extensively used in the poultry industry over the last decade in the context of Nepal. In this study, 66% of Salmonella isolates showed resistance to cefotaxime with MIC of range >2-32 µg/ml. 38% of Salmonella isolates showed resistance to cefotixin with MIC of range >16-256 µg/ml. Similarly, 61% of Salmonella isolates showed resistance to ceftazidime with MIC of range >8-256 µg/ml, and 72% of isolates showed resistance to ceftriaxone with MIC of range >2-32 µg/ml (Table 3). Since extended-spectrum cephalosporin is the antibiotic of choice for treating invasive salmonellosis, resistance to these drugs in veterinary medicine is also a significant concern leading to clinical treatment failures (Iwamoto et al., 2017). Some reported 100% Salmonella resistance to amoxicillin and ampicillin in chicken meat samples (Gautam et al., 2019). A similar study in Chitwan reported 2.7% methicillin resistance gene (mecA) and 0.5% oxacillin resistance gene (Oxa62) in poultry samples (Gyawali, 2018).

3.2.6        MIC of chloramphenicol

In this study, 55% of isolates were chloramphenicol resistant with MIC of range >16-256 µg/mL, and 44% of isolates were susceptible with an MIC of range >2-8 µg/mL (Table 3). The percentage of resistance towards chloramphenicol could be explained by the illegal and fraudulent use of this antimicrobial in veterinary practices in Nepal.

3.2.7        MIC of macrolide

In our study, 88% of Salmonella isolates showed a susceptibility to azithromycin with a range of MIC >0.5-8 µg/ml, while 66% of Salmonella isolates showed a resistance to erythromycin and had a MIC range of >32-256 µg/ml (Table 3). The lower resistance to azithromycin in this study is due to the less use in poultry.

3.2.8        MIC of penicillin

In this study, 77% of Salmonella isolates showed a resistance to amoxicillin and had MIC range of >16-256 µg/ml, while 66% of Salmonella isolates showed a resistance to ampicillin and had MIC of range >32-256 µg/ml (Table 3). The exhibition of higher resistance patterns to the penicillin group of antimicrobials in poultry may well relate to the prolonged use of these antimicrobials (Tenover, 2006).

3.3         Antimicrobial profile of Salmonella isolates

Fig. 3. Antibiotic resistance profiles of salmonella spp. isolates (N=18)

In this study, 18 Salmonella isolates were tested for MIC against 19 antibiotics using the E-strip (Fig. 3). This study revealed the highest number of isolates were resistant to first-line antibiotics: colistin (100%), ciprofloxacin (88%), norfloxacin (72%), amoxicillin (77%), ampicillin (66%), erythromycin (66%), cefotaxime (66%), ceftriaxone (72%), tetracycline (66%), doxycycline (55%), and chloramphenicol (55%). Similarly, amikacin (94%), azithromycin (88%), streptomycin (77%), levofloxacin (72%), gentamicin and cefoxitin (61%), and enrofloxacin (55%) showed the susceptibility pattern, suggesting that limited use and effective control by farmers of these compounds could have a positive influence on AMR.

The frequency of resistance can be explained by the constant and extensive administration of antibiotics in poultry farms, drug abuse, and over-the-counter sales of antibiotics (Upadhyaya et al., 2020). The high resistance rates indicated by this study correlate with antimicrobials commonly used in the visited farms. Thus, drug resistance to clinically important classes of antimicrobials will limit the choices of therapeutic drugs and lead to increased treatment costs. Similarly, among the veterinary critically important antimicrobial agents (VCIA) in the OIE List, some are considered to be critically important both for human and animal health; this is currently the case for fluoroquinolones and the third and fourth generations of cephalosporin. However, Nepalese veterinary drug manufacturers have been importing a substantial amount of these molecules for sale in the Nepalese market, where such sales are generally non- or under-regulated by the authorities (Upadhyaya et al., 2023b).

3.4         Salmonella spp. Multi Drug Resistance (MDR) profile and Multiple Antibiotic Resistance (MAR) index

All isolates in the present study exhibit different multidrug-resistant patterns (Table 4). The results showed that 94.44% (17/18) of the isolated Salmonella were multi-drug resistant (MDR). The majority of the Salmonella isolates were resistant to two or more groups of antibiotics. Based on their resistance to more than three different classes of antibiotics, the MDR Salmonella isolates were chosen. In this profile, 22% of Salmonella isolates were resistant to 10 to 12 antibiotics, 38% to 6 to 8 antibiotics, 27% to 4 to 5 antibiotics, and 11% to 2 to 3 antibiotics.

The isolated Salmonella showed a high proportion of multidrug resistance, which could be due to a number of variables, such as intense selective pressure imposed by haphazard antibiotic usage to treat bacterial illnesses (Wright, 2007). Similarly, numerous antibiotics fixed-dose combinations, i.e., combinations of two or more active antibiotics in a single dosage form, are available in Nepal. Antibiotic FDC are heavily prescribed even without the knowledge of proven advantages over single compounds. Therefore, injudicious use of antibiotic FDCs could lead to the emergence of bacterial strains resistant to multiple antibiotics. Moreover, antibiotics are utilized as a growth promoter in poultry feed and frequently prescribed in Nepal to treat bacterial infections. Therefore, it can be concluded that exposure of a bacterial population (Salmonella) to one antimicrobial agent may result in resistance to other drugs without any prior exposure due to frequent use of antibiotics, making successful antimicrobial therapy more difficult.

The MAR index determines if an isolate originated in an area where antibiotic use was high or low and assesses the extent of antibiotic resistance. An antibiotic abuse pattern is suggested by a MAR index value greater than 0.2. The MAR index was calculated for 18 Salmonella isolates. The analysis revealed that 61% of isolates showed MAR greater than 0.2, indicating that the isolates originated from a high-risk source of contamination where antibiotics are commonly used to a significant degree and/or in large amounts.

The study's findings suggest that multidrug-resistant Salmonella isolated from chicken layer could be a major public health concern. These data demonstrate the presence of multidrug-resistant Salmonella in poultry, showing resistance to ciprofloxacin, ceftriaxone, and gentamicin, commonly used for treating salmonellosis in humans.

Table 4. MDR profile and MAR index of different isolates against antibiotics tested.

No of antibiotic to which isolate was resistant (a)	Antibiotic Resistance Pattern	MAR index (a/b)
2	CTR-CAZ	0.1
3	TET-ERY-COL	0.1
4	TET-ERY-COL-NOR	0.2
	TET-DOX-COL-NOR	0.2
	AMP-CTR-CAZ-COL	0.2
5	AMP-CTR-CAZ-COL-AMX	0.2
	AMP-TET-DOX-COL-AMX	0.2
6	TET-DOX-COL-NOR-CIP-CTR	0.3
	TET-DOX-COL-NOR-ERY-AZI	0.3
7	AMP-CTR-CAZ-COL-AMX-FOX-CTX	0.3
	TET-ERY-COL-NOR-CIP-AMP-AMX	0.3
	AMP-CTR-CAZ-COL-AMX-CTX-FOX	0.3
	TET-DOX-COL-AMX-AMP-CAZ-CTR	0.3
8	TET-ERY-COL-NOR-AMX-AMP-EFX-CHL	0.4
10	TET-DOX-COL-NOR-CIP-AMX-STR-GEN-CHL-CAZ	0.5
11	TET-DOX-COL-NOR-CIP-AMX-STR-GEN-CHL-CAZ-CTR	0.5
	AMP-CTR-CAZ-COL-AMX-NOR-LEV-ERY-STR-AZI-CIP	0.5
12	TET-D0X-NOR-ERY-STR-COL-CHL-AMX-FOX-AMP-CAZ-CTR	0.6

Note: b, the number of antibiotics to which the isolate was exposed (n=19). AMP, ampicillin; AMX, Amoxicillin; AZI, azithromycin; CAZ, ceftazidime; CHL, chloramphenicol; CTR, ceftriaxone; CIP, ciprofloxacin; CTX, cefotaxime; COL, colistin; DOX, doxycycline; EFX, enrofloxacin; ERY, erythromycin; FOX, cefoxitin; GEN, gentamicin; LEV, levofloxacin; NOR, norfloxacin; STR, streptomycin; TET, tetracycline.

4           Conclusion

In conclusion, this study provides baseline quantitative data on the minimum inhibitory concentration (MIC) of commonly used antibiotics in Salmonella spp. isolated from poultry. The majority of isolated Salmonella spp. showed a high rise in MIC concentration and developed resistance to routinely used antibiotic molecules (except Amikacin). It shows a higher risk of therapeutic failure, as the isolates are highly resistant to most of the higher antibiotic concentrations. Therefore, the higher MIC values highlight the need for caution in using these antibiotic molecules and the need for stricter regulations to maintain antibiotic efficacy. The emergence of multidrug-resistant strains, including cephalosporin, fluoroquinolone, and colistin resistance among Salmonella isolates in poultry, poses a serious concern for food safety and public health due to the potential transmission of these resistant variants to humans along the food chain. These observations call for regulation of antibiotic usage in poultry to reduce the risk of antibiotic resistance.

Acknowledgment:

We would like to acknowledge all staff of NAHRC (NARC) and all farmers who help in sample collection.

Funding:

The authors declare no funding source was obtained.

Authors Contribution:

S.S: Writing- Manuscript Daft, Conceptualization, Methodology, Investigation; S.T: Conceptualization, Supervision: N.P: Methodology, Resource, Data analysis, Supervision; J.A: Resources, Conceptualization, Supervision; R.G: Manuscript Prepration

Ethical approval:

This study doesn’t require ethical approval, as animal welfare was not compromised or affected.

Informed consent:

Not applicable.

Conflict of interest statement

The authors declare no conflict of interest.

Data availability statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

 

Reference

Acharya, K. P., Subramanya, S. H., & Lopes, B. S. (2019). Combatting antimicrobial resistance in Nepal: The need for precision surveillance programmes and multi-sectoral partnership. In JAC-Antimicrobial Resistance, 1(3). Oxford University Press, UK. https://doi.org/10.1093/jacamr/dlz066